ID: 1181121462_1181121471

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1181121462 1181121471
Species Human (GRCh38) Human (GRCh38)
Location 22:20670428-20670450 22:20670451-20670473
Sequence CCCAGGCTGAGCTGCCCCCAGGG TCGCCCTCACCTGGTGCGCAGGG
Strand - +
Off-target summary No data {0: 10, 1: 1, 2: 0, 3: 6, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!