ID: 1181177605_1181177606

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1181177605 1181177606
Species Human (GRCh38) Human (GRCh38)
Location 22:21046507-21046529 22:21046523-21046545
Sequence CCTGACTCTGGCAGGATTAGCTA TTAGCTACCACCACTAGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!