ID: 1181188207_1181188214

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181188207 1181188214
Species Human (GRCh38) Human (GRCh38)
Location 22:21121043-21121065 22:21121081-21121103
Sequence CCCAGGCATTGTTTGTAAACCCT CAAAGAAAACAGAAGCATGGAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 8, 3: 11, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!