|
Left Crispr |
Right Crispr |
| Crispr ID |
1181189156 |
1181189157 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
22:21126409-21126431
|
22:21126424-21126446
|
| Sequence |
CCTGCTGCAGCTGTGGCTGAGGC |
GCTGAGGCCCAGAAATGTGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 2, 2: 5, 3: 200, 4: 3037} |
{0: 14, 1: 25, 2: 11, 3: 102, 4: 614} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|