ID: 1181210825_1181210840

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1181210825 1181210840
Species Human (GRCh38) Human (GRCh38)
Location 22:21288464-21288486 22:21288511-21288533
Sequence CCCCTCCTGGAGAACGCTGCGTT ACCACACAGGCTGTTGAGGCAGG
Strand - +
Off-target summary No data {0: 10, 1: 1, 2: 0, 3: 16, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!