ID: 1181240408_1181240423

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181240408 1181240423
Species Human (GRCh38) Human (GRCh38)
Location 22:21474054-21474076 22:21474105-21474127
Sequence CCATCCTCCCTTTGTTCAGGCCG CAGCAGGGAGCCTGTCAGCCCGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 49, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!