ID: 1181256724_1181256731

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1181256724 1181256731
Species Human (GRCh38) Human (GRCh38)
Location 22:21567697-21567719 22:21567726-21567748
Sequence CCGGCCGGCCGCGATGCATTCTG GAGCAGCACCAAATCCAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32} {0: 2, 1: 2, 2: 2, 3: 25, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!