ID: 1181507852_1181507861

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1181507852 1181507861
Species Human (GRCh38) Human (GRCh38)
Location 22:23373708-23373730 22:23373744-23373766
Sequence CCTTGAAGGCCCAGTTCCCGGGA ATGTGCTGAGGACAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!