ID: 1181550935_1181550943

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1181550935 1181550943
Species Human (GRCh38) Human (GRCh38)
Location 22:23638839-23638861 22:23638878-23638900
Sequence CCGGATAAAGTTATTCATGAGAC GTTGGCTTGGGGCTCCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148} {0: 1, 1: 0, 2: 4, 3: 15, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!