ID: 1181568388_1181568397

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181568388 1181568397
Species Human (GRCh38) Human (GRCh38)
Location 22:23753067-23753089 22:23753097-23753119
Sequence CCCGCTGCTGGTACCAGGACACA CCCTGATGGTGACGTGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189} {0: 1, 1: 0, 2: 1, 3: 8, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!