ID: 1181699067_1181699074

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1181699067 1181699074
Species Human (GRCh38) Human (GRCh38)
Location 22:24609723-24609745 22:24609758-24609780
Sequence CCCTCTTCCCTGTTGTCACACCT CATAGCCATGAGACTTCCCAAGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 4, 3: 15, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!