ID: 1182305142_1182305149

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1182305142 1182305149
Species Human (GRCh38) Human (GRCh38)
Location 22:29362771-29362793 22:29362802-29362824
Sequence CCCACCTACTCCAGTTAACTCAC CACCTGACCTGTCAGTGTCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 18, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!