ID: 1182314811_1182314816

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1182314811 1182314816
Species Human (GRCh38) Human (GRCh38)
Location 22:29438533-29438555 22:29438556-29438578
Sequence CCTAGGAGGAGGTGAAATGACCC CAGCTCGCTGTTCCTCACATGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 12, 4: 182} {0: 3, 1: 0, 2: 1, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!