ID: 1182412948_1182412952

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1182412948 1182412952
Species Human (GRCh38) Human (GRCh38)
Location 22:30202619-30202641 22:30202644-30202666
Sequence CCCAGCCTGAGTAACGAAGCTCA AAACAAAACAGTAACTGCTCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 42, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!