ID: 1182475703_1182475713

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1182475703 1182475713
Species Human (GRCh38) Human (GRCh38)
Location 22:30575225-30575247 22:30575267-30575289
Sequence CCAGGCCCTGTCTCATTTTCCAG ACCCCAGAGGAGCAAGACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 398} {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!