ID: 1183183575_1183183580

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1183183575 1183183580
Species Human (GRCh38) Human (GRCh38)
Location 22:36278189-36278211 22:36278219-36278241
Sequence CCCGGCCACTAGCAGTGTCTCAT CCTTTTTGTCTTTCCTCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 801} {0: 1, 1: 0, 2: 0, 3: 33, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!