ID: 1183191625_1183191638

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1183191625 1183191638
Species Human (GRCh38) Human (GRCh38)
Location 22:36325340-36325362 22:36325393-36325415
Sequence CCACACCCCAGACCTGCATGCAG CACACGGCACGCCAGTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 427} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!