ID: 1183191632_1183191639

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1183191632 1183191639
Species Human (GRCh38) Human (GRCh38)
Location 22:36325371-36325393 22:36325402-36325424
Sequence CCCTCCTTACTTACGAAGGCCGC CGCCAGTAAGGTGGAGCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27} {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!