ID: 1183191634_1183191645

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1183191634 1183191645
Species Human (GRCh38) Human (GRCh38)
Location 22:36325375-36325397 22:36325425-36325447
Sequence CCTTACTTACGAAGGCCGCACAC GAGCGGCCAAGCTCCCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23} {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!