ID: 1183665671_1183665678

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1183665671 1183665678
Species Human (GRCh38) Human (GRCh38)
Location 22:39244514-39244536 22:39244535-39244557
Sequence CCCGGGCAGGGAGAGGTGCAAAC ACTCCCGCCCGGGCCGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 234} {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!