ID: 1183665671_1183665684

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1183665671 1183665684
Species Human (GRCh38) Human (GRCh38)
Location 22:39244514-39244536 22:39244541-39244563
Sequence CCCGGGCAGGGAGAGGTGCAAAC GCCCGGGCCGGGTAGGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 234} {0: 1, 1: 0, 2: 2, 3: 88, 4: 806}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!