ID: 1183683678_1183683688

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1183683678 1183683688
Species Human (GRCh38) Human (GRCh38)
Location 22:39349915-39349937 22:39349942-39349964
Sequence CCGGCCGCGCGCGCAGGGGAGGG GGGGCGCCGCGCACGCGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 221} {0: 1, 1: 0, 2: 0, 3: 32, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!