ID: 1184100299_1184100311

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1184100299 1184100311
Species Human (GRCh38) Human (GRCh38)
Location 22:42338456-42338478 22:42338491-42338513
Sequence CCTCCCGGCAGCCCGGCCTGCAG CAATCCCGAAGAGCTCGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 395} {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!