ID: 1184100304_1184100313

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1184100304 1184100313
Species Human (GRCh38) Human (GRCh38)
Location 22:42338460-42338482 22:42338493-42338515
Sequence CCGGCAGCCCGGCCTGCAGGGGC ATCCCGAAGAGCTCGCTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 46, 4: 542} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!