ID: 1184101608_1184101626

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1184101608 1184101626
Species Human (GRCh38) Human (GRCh38)
Location 22:42344040-42344062 22:42344070-42344092
Sequence CCCGCCCACCCGCGCCCAGCCCC CGGTGCCGCTGCTGGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 202, 4: 2007} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!