ID: 1184141813_1184141828

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1184141813 1184141828
Species Human (GRCh38) Human (GRCh38)
Location 22:42581962-42581984 22:42582009-42582031
Sequence CCGGGTCCCGCGCCGCGAGCTTC CCCGGGAGCGCGGGGGTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 104} {0: 1, 1: 1, 2: 2, 3: 51, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!