ID: 1184141814_1184141830

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1184141814 1184141830
Species Human (GRCh38) Human (GRCh38)
Location 22:42581968-42581990 22:42582010-42582032
Sequence CCCGCGCCGCGAGCTTCGTCCTG CCGGGAGCGCGGGGGTCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 1, 2: 1, 3: 37, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!