ID: 1184141827_1184141832

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1184141827 1184141832
Species Human (GRCh38) Human (GRCh38)
Location 22:42582009-42582031 22:42582023-42582045
Sequence CCCGGGAGCGCGGGGGTCGCCGG GGTCGCCGGGAGTTGCGGTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 34, 4: 229} {0: 1, 1: 1, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!