ID: 1184465293_1184465300

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1184465293 1184465300
Species Human (GRCh38) Human (GRCh38)
Location 22:44665404-44665426 22:44665432-44665454
Sequence CCACCCAGGTCAGCCTCAGGGAG AGTAGGCAGTGAATGGATCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!