ID: 1184465293_1184465305

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1184465293 1184465305
Species Human (GRCh38) Human (GRCh38)
Location 22:44665404-44665426 22:44665442-44665464
Sequence CCACCCAGGTCAGCCTCAGGGAG GAATGGATCTGGGGAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 506} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!