ID: 1184670103_1184670113

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1184670103 1184670113
Species Human (GRCh38) Human (GRCh38)
Location 22:46007833-46007855 22:46007869-46007891
Sequence CCGGCCTGAAGTCCGGCTCCTGT GGCCCTTGTGCGGTGGCGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!