ID: 1184956705_1184956711

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1184956705 1184956711
Species Human (GRCh38) Human (GRCh38)
Location 22:47892056-47892078 22:47892084-47892106
Sequence CCCCTGCTGAGAAGCAGGAGCCA AGGTTCTAGAACCACAAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!