ID: 1185109924_1185109930

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1185109924 1185109930
Species Human (GRCh38) Human (GRCh38)
Location 22:48895127-48895149 22:48895153-48895175
Sequence CCTGGGCAGCTGCCATGTGCACC AGGCTTCAGACTCCTGGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 256} {0: 1, 1: 0, 2: 1, 3: 32, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!