ID: 1185170511_1185170520

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1185170511 1185170520
Species Human (GRCh38) Human (GRCh38)
Location 22:49291064-49291086 22:49291103-49291125
Sequence CCTTACTCTACCCTTAGCAGAAA GGCTTCCTTCTCCCGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 157} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!