ID: 1185277264_1185277270

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1185277264 1185277270
Species Human (GRCh38) Human (GRCh38)
Location 22:49955178-49955200 22:49955199-49955221
Sequence CCACCACCACCTCTCCTGAGTCT CTCCTCCTCATCAGAATGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!