ID: 1185344701_1185344713

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1185344701 1185344713
Species Human (GRCh38) Human (GRCh38)
Location 22:50306207-50306229 22:50306232-50306254
Sequence CCCCTGGCCAGACCTCAGGCCTC AGACCCCCCGGGACAGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!