ID: 1185420081_1185420090

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1185420081 1185420090
Species Human (GRCh38) Human (GRCh38)
Location 22:50730343-50730365 22:50730380-50730402
Sequence CCAAGTCTCAGCGTCCCGGGTAT ATGCCCAGAGCCGGTGTCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!