ID: 1185469999_1185470009

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1185469999 1185470009
Species Human (GRCh38) Human (GRCh38)
Location X:376534-376556 X:376567-376589
Sequence CCACACCCAGTGGGGCCGCCATG TACACTACTGTATGCAGGGACGG
Strand - +
Off-target summary No data {0: 12, 1: 1, 2: 16, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!