ID: 1185470031_1185470040

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1185470031 1185470040
Species Human (GRCh38) Human (GRCh38)
Location X:376656-376678 X:376685-376707
Sequence CCACACCCAGTGGGGCCACCATG TCTATACACTACTGTGTACAGGG
Strand - +
Off-target summary No data {0: 28, 1: 2, 2: 25, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!