ID: 1185470259_1185470272

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1185470259 1185470272
Species Human (GRCh38) Human (GRCh38)
Location X:377547-377569 X:377595-377617
Sequence CCACACCCAGTGGGGCCACCATG AGGGACGGGCCGTCTACAGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 0, 3: 1, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!