ID: 1185488638_1185488641

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1185488638 1185488641
Species Human (GRCh38) Human (GRCh38)
Location X:501567-501589 X:501590-501612
Sequence CCAGGATGGAGCTGGAGTCAAGC CTGCTGTGTAGACGGCCATTAGG
Strand - +
Off-target summary No data {0: 6, 1: 13, 2: 9, 3: 17, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!