ID: 1185503349_1185503351

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1185503349 1185503351
Species Human (GRCh38) Human (GRCh38)
Location X:615395-615417 X:615414-615436
Sequence CCAAAGACACCAGAAAAACTAGA TAGAATCCATCTTCCCCAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 83, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!