ID: 1185549486_1185549487

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1185549486 1185549487
Species Human (GRCh38) Human (GRCh38)
Location X:971872-971894 X:971889-971911
Sequence CCACACTTTGCAATAGACACACT CACACTCAATGTCCTCCATCTGG
Strand - +
Off-target summary No data {0: 13, 1: 15, 2: 6, 3: 23, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!