ID: 1185553581_1185553587

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1185553581 1185553587
Species Human (GRCh38) Human (GRCh38)
Location X:1002927-1002949 X:1002943-1002965
Sequence CCCATTTTCTCCTCGGCCGGGCC CCGGGCCATACCAGCGGGAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!