ID: 1185585036_1185585045

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1185585036 1185585045
Species Human (GRCh38) Human (GRCh38)
Location X:1236475-1236497 X:1236497-1236519
Sequence CCCCTACTGGGAAGTGAGCCCCT TCTGCCCTCTGGGCCCGTCTGGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 4, 3: 219, 4: 3795} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!