ID: 1185585047_1185585051

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1185585047 1185585051
Species Human (GRCh38) Human (GRCh38)
Location X:1236501-1236523 X:1236526-1236548
Sequence CCCTCTGGGCCCGTCTGGGAGGT GCCCAACAGCTCATTGAGAACGG
Strand - +
Off-target summary No data {0: 406, 1: 1143, 2: 373, 3: 77, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!