ID: 1185585047_1185585055

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1185585047 1185585055
Species Human (GRCh38) Human (GRCh38)
Location X:1236501-1236523 X:1236542-1236564
Sequence CCCTCTGGGCCCGTCTGGGAGGT AGAACGGGCCATGATGACGATGG
Strand - +
Off-target summary No data {0: 414, 1: 1018, 2: 754, 3: 186, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!