ID: 1185620011_1185620014

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1185620011 1185620014
Species Human (GRCh38) Human (GRCh38)
Location X:1448253-1448275 X:1448277-1448299
Sequence CCACCATCTTGGACACACAACAT TTGGACACACACCGCCATCTTGG
Strand - +
Off-target summary No data {0: 17, 1: 19, 2: 26, 3: 16, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!