ID: 1185777139_1185777143

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1185777139 1185777143
Species Human (GRCh38) Human (GRCh38)
Location X:2812476-2812498 X:2812500-2812522
Sequence CCCTCTAACTCATACCTTCTTTG GTCCCCGAAGGAAACCAGAAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!