ID: 1185835935_1185835945

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1185835935 1185835945
Species Human (GRCh38) Human (GRCh38)
Location X:3346109-3346131 X:3346158-3346180
Sequence CCCACCGATTGCAAGAGCAGAGT AGCTTCCTAGAAACGCGGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!